Monday, September 30, 2019

Functional Areas in Business

Task 1: Research different functional areas, provide definitions of each of these functions: * Customer Servise Customer service is the provision of service to customers before, during and after a purchase. Customer service is a series of activities designed to enhance the level of customer satisfaction – that is, the feeling that a product or service has met the customer expectation. Its importance varies by products, industry and customer; defective or broken merchandise can be exchanged, often only with a receipt and within a specified time frame.Retail stores often have a desk or counter devoted to dealing with returns, exchanges and complaints, or will perform related functions at the point of sale; the perceived success of such interactions being dependent on employees â€Å"who can adjust themselves to the personality of the guest, customer service plays an important role in an organization's ability to generate income and revenue. From that perspective, customer servi ce should be included as part of an overall approach to systematic improvement.A customer service experience can change the entire perception a customer has of the organization. * ICT Stands for â€Å"Information and Communication Technologies. † ICT refers to technologies that provide access to information through telecommunications. It is similar to Information Technology (IT), but focuses primarily on communication technologies. This includes the Internet, wireless networks, cell phones, and other communication mediums. In the past few decades, information and communication technologies have provided society with a vast array of new communication capabilities.For example, people can communicate in real-time with others in different countries using technologies such as instant messaging, voice over IP (VoIP), and video-conferencing. Social networking websites like Facebook allow users from all over the world to remain in contact and communicate on a regular basis. Modern in formation and communication technologies have created a â€Å"global village,† in which people can communicate with others across the world as if they were living next door. For this reason, ICT is often studied in the context of how modern communication technologies affect ociety. * Distribution Distribution means ensuring that goods are delivered to the right place on time and in the right condition. Commerce: The movement of goods and services from the source through a distribution channel, right up to the final customer, consumer, or user, and the movement of payment in the opposite direction, right up to the original producer or supplier. Securities: Payment of principal, interest, or dividend by the issuer of a security to the security holders, on a regular (typically monthly or quarterly) basis.Statistics: An order or pattern formed by the tendency of a sufficiently large number of observations to group themselves around a central value. The familiar bell-shaped curve is an example of normal distribution in which the largest numbers of observations are distributed in the center, with progressively fewer observations falling evenly on the either side of the center (average) line. See also frequency distribution, normal distribution, and standard distribution. * Marketing The management process through which goods and services move from concept to the customer.As a practice, it consists in coordination of four elements called 4P's: (1) identification, selection, and development of a product, (2) determination of its price, (3) selection of a distribution channel to reach the customer's place, and (4) development and implementation of a promotional strategy. As a philosophy, marketing is based on thinking about the business in terms of customer needs and their satisfaction. Marketing differs from selling because (in the words of Harvard Business School's emeritus professor of marketing Theodore C.Levitt) â€Å"Selling concerns itself with the trick s and techniques of getting people to exchange their cash for your product. It is not concerned with the values that the exchange is all about. And it does not, as marketing invariably does, view the entire business process as consisting of a tightly integrated effort to discover, create, arouse, and satisfy customer needs. † * Human resources The division of a company that is focused on activities relating to employees. These activities normally include recruiting and hiring of new employees, orientation and training of current employees, employee benefits, and retention.Formerly called personnel. * Sales The activity or business of selling products or services. Contract involving transfer of the possession and ownership (title) of a good or property, or the entitlement to a service, in exchange for money or value. Essential elements that must be present in a valid sale are (1) competence of both the buyer and seller to enter into a contract, (2) mutual agreement on the terms of exchange, (3) a thing capable of being transferred, and (4) a consideration in money (or its equivalent) paid or promised. Finance Finance is the study of how investors allocate their assets over time under conditions of certainty and uncertainty. A key point in finance, which affects decisions, is the time value of money, which states that a unit of currency today is worth more than the same unit of currency tomorrow. Finance aims to price assets based on their risk level, and expected rate of return. Finance can be broken into three different sub categories: public finance, corporate finance and personal finance. * ProductionThe processes and methods employed to transform tangible inputs (raw materials, semifinished goods, or subassemblies) and intangible inputs (ideas, information, knowledge) into goods or services. * Research and development Systematic activity combining both basic and applied research, and aimed at discovering solutions to problems or creating new goods and knowledge. R&D may result in ownership of intellectual property such as patents. In accounting for R&D costs, the development costs may be carried forward but the basic and applied research costs are often written-off as incurred. Administration Management: The interpretation and implementation of the policy set by an organization's board of directors. The administration of a business is synonymous with the performance or management of business operations, maybe including important decision making. Thus it is likely to include the efficient organization of people and other resources so as to direct activities toward common goals and objectives. Task 2: Using Newcastle College website find out about entry requirements to a Level 3 Business related course: 5 GCSEs A – C or equivalent at Pass level, ideally inc English ; Maths.If English is not your first language you will need an IELTS score of 5. Task 3: Using the college library research using a book the area of business you are most interested in: Business administration is the process of managing a business or non-profit organization so that it remains stable and continues to grow. This consists of a number of areas, ranging from operations to management. There are many different roles related to business administration, including business support, office manager, and Chief Executive Officer (CEO), among others. Most companies have a dedicated group of administrators.Main Areas The main areas incorporated into business administration are operations, logistics, marketing, economics, Human Resources (HR), and management. An administrator oversees these parts of an organization to make sure that they're all functioning properly and efficiently individually, and that they're all working together to make the business profitable. He or she may also come up with ways to make the department more profitable, and often delegates tasks to employees in the department. Large companies usually have at least one ad ministrator assigned to each area. RolesMost companies have a range of administrative roles in different parts of their corporate hierarchy. At the office level, there are business support officers, who might develop and maintain an office database, oversee other employees for projects, and help the manager with analyzing performance trends. At the next level there are office managers, who oversee an entire office, make budgets and analyses of staff performance, design procedures, and assign projects, among other things. If an organization is large, it may have several assistant managers to help the overall office manager.After office-level managers, there are division administrators, who oversee large portions of an organization. They generally specialize in one area of business administration. For instance, a company might have a person with a specialization in HR administration oversee that department and make sure it's working efficiently to meet the business' overall goals. Thi s includes things like measuring the performance of HR staff members, hiring new staff for the department if needed or getting rid of non-performing staff, and making sure that the process for hiring is workable.The head of overall operations in business administration is usually referred to as the chief executive officer (CEO) or president. The CEO and president may be the same office, but this varies between companies. The CEO, depending on the size of the company, may have several vice presidents, each responsible for one area of company operations. For example, there could be a vice president for marketing, one for research and design, and one for sales or customer relations. Each of these operate independently. Work EnvironmentThe work environment for someone in business administration depends largely on the type of job he or she is doing. Those on the lower end of the hierarchy often work in structured environments and make frequent reports to their superiors, while those high er up may have more freedom with their schedules. Depending on the type of organization, work hours may be 9 to 5 or they may be more flexible. Overtime is often required when big projects are nearing completion, or when annual analyses and presentations need to be made.Generally speaking, anyone in this type of position needs to have excellent communication skills, as he or she will be working with a lot of different people, sending out memos, and making reports. They also need to be comfortable with making presentations, and they need to be able to lead people. Another important skill is being able to understand how many different parts of a system or organization work together, so that they can make workable systems and figure out what's wrong with those that don't work.Most are also very good at math and have an understanding of economics, since they usually make budgets and analyze their office, department, or company's performance. Education Many universities offer business ad ministration programs for both online and offline study. A typical curriculum covers the critical aspects of operating a business such as customer service, business finance, marketing, and human resources. Aspiring administrators can improve their marketability by minoring in a related field such as an applied science for engineering or psychology for marketing and sales.Most large companies want applicants that have at least a master's degree in a business-related field. This involves getting hands-on experience, typically by interning at a corporation to get a feel for how the different aspects fit together. Depending on a student's chosen area, he or she may need to write and enact a business plan to prove your competency; for example, he or she might need to come up with a marketing or sales plan for a hypothetical product, targeting it at a given demographic.

Sunday, September 29, 2019

A Ready and Modern Army, a Strategic Priority

Planning Guidance, the Army will focus on five strategic priorities to meet the Nation's strategic imperatives. Although all of these priorities are significant, the strategic priority â€Å"A Ready and Modern Army† is the most important because it directly impacts the Army's ability to respond when called upon. â€Å"A Ready and Modern Army' strategic priority affects the Army's personnel, equipment, supplies, and training.One thing is non-negotiable: Americans expect and trust that their Army is properly trained and deployment ready at any given time. It is important to note that in a time of budget cuts and manpower reduction, balancing readiness and modernization will continue to be an issue across the entire Department of Defense. Nevertheless, the Army will need to continue to scale its forces into scalable, well-equipped, and highly trained force in order to maintain readiness in an unpredictable world where modernization is absolutely necessary for the Nation to addre ss future global trends.Additionally, it is crucial that the Army continues to conduct rigorous and practical training at home stations at multi-echelon levels and leverage modern technologies such as virtual and emulation capabilities. Finally, the Army needs to capitalize more on the skills and knowledge of the Army National Guard and Army Reserve as well as having the right mix of capabilities in order to establish and maintain a globally responsive and regionally-engaged force.Overall, â€Å"A Ready and Modern Army' means that the Army will need to holistically look at Its personnel, equipment, supplies, and training and determine the best way to Integrate operations where It makes sense to provide the most efficient and effective solution. The need for Integration Is even more critical In the context of the foreseeable fiscal environment.

Saturday, September 28, 2019

Lizard People Essay

Independence Day in Los Angeles. Its approximate location was at what is now the Hollywood Freeway near the intersection of North Hill Street and West Cesar Chavez Avenue, downtown. The hill was located one block north of Temple Street and a short distance south of present day Cesar Chavez Avenue, between the Los Angeles Civic Center and Chinatown. A small portion of the hill was not bulldozed and remains on the west side of Hill Street on the north side of the freeway. Part of Fort Moore Hill became home to a cemetery, with the first documented burial tracing back to December 19, 1853. Alternately known as Los Angeles City Cemetery, Protestant Cemetery, Fort Moore Hill Cemetery, Fort Hill Cemetery, or simply â€Å"the cemetery on the hill†, it was the city’s first non-Catholic cemetery. In 1891, the site became home to the second location of Los Angeles High School (LAHS), located on North Hill Street between Sand Street (later California Street, now part of 101 Freeway) and Bellevue Avenue (later Sunset Boulevard, now Cesar Chavez Avenue). LAHS was at this location on Fort Moore Hill until 1917, when the high school was moved again. Most of Fort Moore Hill was removed in 1949 for the construction of the Hollywood Freeway, which was opened in December 1950, and in 1957 a memorial for the old fort and its American pioneers was placed on a site north of the freeway. The fort is now memorialized by the Fort Moore Pioneer Memorial. According to a G. Warren Shufelt, a geophysicist mining engineer deep beneath the heart of Los Angeles’ financial district (Fort Moore Hill) hundreds of feet below corporate offices, and government offices lies another city. Beneath Los Angeles’ Downtown area stands a lost city of catacombs filled with treasure and records. A Hopi chief named Little Green told Warren Shufult that the vanished race’s capital was located in modern day Downtown Los Angeles. This city derived from an Indian legend that an underground world was built by a strange race that vanished 5000 years ago. This race is commonly referred to as the Lizard People or Lizard men. Warren Shufult first heard of the Lizard people in the city of a Hopi Indian legend. Legend is that they were a race who had been nearly wiped out by a meteor shower around 3000 BC. The lizard people then constructed 13 subterranean settlements along the Pacific Coast. This was done to shelter themselves against future detriments. Each subterranean settlement is what we call in modern times a city, in which was divided to house a thousand families each. They also stockpiled essentials of life to maintain. So greatly advanced scientifically the Lizard people developed a chemical solution that melted solid bedrock to bore out the tunnels and rooms of their subsurface shelters. This was done without removing any earth and rock. They also developed a cement tar stronger than any in use in modern times which they lined their tunnels and rooms. These tunnels were also constructed to hold a profusion of gold tablets that chronicled the history of their existence, the origin of mankind, and the story of the world back to creation. The Lizard people according to Little Chief Greenleaf of the medicine lodge of the Hopi Indians in Arizona, were of a much higher type of intellectually than modern human beings. The intellectual accomplishments of their 9 year old children were equal of those of present day college graduates. According to the reporter Jean Bosquet of the Los Angeles Times in 1934, Warren Shufelt began o drive a shaft 250 feet into the ground on North Hill Street, overlooking Sunset Boulevard, Spring Street and North Broadway. Warren Shufelt engineered a radio x- ray for detecting the presence of minerals and tunnels below the surface of the ground. This was an apparatus with which he says that he has traced a pattern of catacombs and vaults forming a lost city. The radio device consisted of a cylindrical glass case with a plummet attached to a copper wire.

Friday, September 27, 2019

10 Activity (Speech) Reports Essay Example | Topics and Well Written Essays - 5000 words

10 Activity (Speech) Reports - Essay Example He also worked alongside United States President Barack Obama, serving on the Presidential Transition Team where he served as the economic agency review group head. He has worked extensively on international law policy and has also authored a number of books that discuss the relationship and impacts of foreign economics such as In China’s Shadow: The Crisis of American Entrepreneurship where there is a direct impact that since a lot of business and manufacturing has shifted to China, it directly impacts the United States because of lost jobs and wages for the people in America. Firestone is the executive director of the Aspen Institute Communications and Society Program and has worked extensively on how new communications policies models are important. With globalization of the economy, it is necessary for all people to remember to be aware of other cultures, their technologies, and ability to communicate and be socio-economic when dealing with other countries. As an attorney, he worked at the Federal Communications Commission as well. He has also penned several books including Digital Broadcasting and the Public Interest and Television and Elections. Hundt and Firestone delivered a message that discussed that the network economy is part of the economy in which it is part of the society of information. Nothing is localized anymore. Especially with communication through social media, there is information available to people at any given time, all across the world. Of course, with Firestone’s background as an attorney, he offered information discussing the different policies across the world. Although each country may be working together, each one may have different policies in regards to the economy. Every country has its own set of laws and it is important to be mindful of them. In this discussion, it was quite informative that in regards to a

Thursday, September 26, 2019

Business-Level and Corporate-Level Strategies Assignment

Business-Level and Corporate-Level Strategies - Assignment Example Moreover, AT&T provides GSM, TDMA and UMTS services. These are the example of niche marketing activities. AT&T has started to sell their wireless and GSM services in iphone, collaborating with Apple Corporation (Grant and Meadows, 2012). Its exclusive accord to competitive market place has differentiated AT&T from its potential competitors. Vast spectrum utilization of AT&T offers its subscribers the video conferencing service. AT&T wireless is the only telecom company in US market that promises; people can get connected with each other anywhere and anyway by its efficient telecom service. AT&T has successfully diversified their business in several international markets. It is the leading wireless service provider in global market that provides Voice-IP, Voice-PTT, HSPDA and video sharing. Moreover, efficient channel exposure has increased the competitive advantage of AT&T. The story of AT&T depicts the 130 years old history. The old giant company has efficiently served the customers in telecommunication sector. From the foundation in 1875 by Graham Bell to this present era, the global telecommunication industry has evidenced several key events of AT&T. The study focuses on the corporate-level strategies of AT&T. After the successful invention of telephone in the year 1875 by Graham Bell, the company has diversified their business. The vertical integration of the company created the opportunity of transferring the corporate skills of the company. In an addition, BTC also did acquisitions of many licenses. It actually increases the market power of BTC. Years after years the both vertical and horizontal integration helped BTC to create the economies of scope. Moreover, they have continuously generated the know-how technology. The monopolistic status of the company resulted many filed regulation suits. At one point of time AT&T lost the brand image and huge market share due to

Micro economics Essay Example | Topics and Well Written Essays - 1500 words

Micro economics - Essay Example But the other side of picture is also being supportedby many economists. They are of the view that UK is still in the grasp of double dip depression. According to a study, in the year 2008 peak the growth rate of economy was less than 20.1% and in the year 2010, the overall growth rate is around 6.1% which shows a serious plunge during the great depression. International monetary fund issued a forecast about the growth rate in between 0.6% to 0.8 % and this is not considered as a gratifying rate. Since 2008, the government of UK has stimulated up to 380 billion pounds into the economic machinery to increase liquidity rates but due to the lack of â€Å"trickle down† effect, the money has not shown its benefits and didn’t reach the core level of the industries. Many unconventional and out of the way step and initiatives are being taken to solve the problem of liquidity. Massive job lose statistics showed that there were around 750,000 public sector jobs that were cut off but this problem has been sorted out after the pact between democrats and conservatives. During the nine months of double dip depression, the economy of UK shrank up to around 1.1 pc (Kirby et al, 2011) and there is now a rise in the growth that shows that depression has ended. The economists are feeling the fear that the depression can come because economic depressions re-appear and do not go away easily. The measures by the ONS say that the economy grew by 0.7per capita and many other independent sources for example a renowned economist named as Samuel Tombs is supporting the view that growth will touch around 0.6pc. Till 2012, depression was still badly affecting the UK’s economy as this was the consequence of bankruptcies of major banks like Lehman brothers and the stock markets of UK were falling to the lowest records since the great depression. The measures from NIESR says that double dip depression was still there until September 2012 as after pumping thousands of doll ars in the banking systems , there was no rise in the growth of the economy (Hay, 2012). Question 2 There are mainly four categories of unemployment, as follows 1) Structural Unemployment 2) Frictional Unemployment 3) Cyclic Unemployment 4) Seasonal Unemployment (Boyes& Melvin, 2012) The first type of unemployment is when the competent work force is available but there is a huge lack of demand for them. This kind of unemployment is highly proliferated in the world. The second type refers to the unemployment that is caused due to high â€Å"switch rate† of employees between different jobs. The third type is because of the effects of overall growth of the economic conditions and fourth type is because of the fluctuations of international economic trends and developments. Diamond Mortensen Pissarides (DMP) model illustrates the unemployment as a function of limited variables ad the rate of unemployment is directly proportional to the number of variables. If people have limited m eans and skill sets, unemployment will expand automatically. This model is regarded as the most practical one. According to DMP model, the bargain rate between employee and employer is also affected due to unemployment rate. If unemployment rate is high, bargain will be low because hiring is a difficult process altogether. As shown in the above figure, if the productivity in decreased, there is also a decline in Nash’s wage line. A high rate of wage line depicts less unemployment and sound economic condition

Wednesday, September 25, 2019

Is pricing promotion the most efficient online shopping market Essay

Is pricing promotion the most efficient online shopping market strategy to attract Chinese college students - Essay Example keting idea 21 Chapter#3: Methodology 22 3.1. Research Philosophy 22 3.2. Research methods 22 3.3. Research design 23 3.3.1. Purpose 23 3.3.2. Research option 23 3.4. Research Strategy 23 3.5. Time Horizon 24 3.6. Design of Sample 24 3.7. The process of research techniques 25 3.7.1. The collection of primary statistic 25 3.7.1.1. Questionnaire 25 3.7.1.2. The Interview 25 3.8. Ethical Considerations 26 3.8.1. The research process is affected by Ethical issues generally 26 3.8.2. Ethical issues during design the questionnaire 26 3.8.3. Ethical issues in the process of data collection 26 3.8.4. Ethical issues connected with the emphasis and analysis 27 3.9. Limitation of the research 27 Chapter#4: Analysis of questionnaire 28 Analysis of students choose online shopping 28 The analysis of students' online shopping expansion 28 The types of goods characteristics of online shopping 29 Criteria characteristics of college students’ online shopping 29 Students choose online shopping w ebsite analysis 30 Analysis of problems encountered by students online shopping 30 College students think online shopping insufficient analysis 30 Analysis of characters of issues needs to be perfect 31 Analysis of College students’ the prospection towards online shopping 31 Analysis towards Other factors 31 The interview to stuff of TaoBao 32 The standardization of website’s specialized products and information 32 To maintain the level of moderately priced 33 Establishment of regional storage center 33 Accurate and efficient promotional strategy 33 Improvement of after-sales service 34 Seriously deal with complaints 34 Problem of college students shopping online 35 Business credit is low 35 The problem of security 35 Legal system for online shopping is not perfect 36 Logistics service of net purchases is poor 36 Students’ consciousness of rights safeguard is weak 36 After-sales service of net purchases cannot be achieved 36 Countermeasures to enhance college st udents online shopping 37 Students should strengthen self-protection awareness 37 Industry self-regulation 37 Improvement of network technology 37 Enhance the integrity of online shopping 38 Enhance network security of the enterprise 38 Simplify the refund process 38 Improving the safety factor in the payment process 38 Develop specialized e-commerce law and legal system for online shopping 39 Government’s support 39 Strengthen macro-control and management of the online shopping market 39 Speed up the construction of information infrastructure 39 Improve the express online shops’ logistics service level 40 Introduction of the "logistics insurance 40 Chapter# 5: Conclusion 41 5.1. Study’s conclusion 41 5.2. The Limitation of this research 42 5.3. The direction of further study 43 6. References 44 Abstract This paper introduces Fujian University students for the survey and interviews stuffs from the biggest online shopping website in China-TaoBao, conducted a stud y to analyze college students online shopping situation. The study found that although the online shopping phenomenon is quite common among college students, especially penetration rate of boys online shopping is higher, but the integrity of the online shopping merchants, payment security, imperfect laws and problems of regulations towards online shopping restrict the development of e-commerce network. Because of

Tuesday, September 24, 2019

Role of Nursing in Healthcare Delivery Coursework

Role of Nursing in Healthcare Delivery - Coursework Example Therefore we can say that in this modern century the role of nursing managers has somewhat change now. In addition to the direct clinical and medical care, the nurses are involved in many other aspects of the health care industry. The additional duties may also include quality management and improvement, case management, data collection and analysis, insurance review analysis, patient educations and sometimes the regular training programs to train the rest of the medical staff (Cipriano, 2010). All of these additional tasks are included in the roles, duties or we can say responsibilities of a nurse manager. In modern times, the nurses are also named as the health providers and the health researchers. At higher level of nursing managers, the duties and the responsibilities of a nurse may change from others. A nurse manger may have to supervise all the staff and the hospital just to coordinate their activities. The budgeting activity may also fall on the shoulders of a nurse manger so that he or she can manage the allocated budget according to the proper planning. The hospital may get famous by the level of its services and the care, which they give to their patients; therefore, it is the role of the nurse manager to maintain the high quality or the standard of the health care services (Donovan, 2010). Nurses play an important or we must say a central role in the cost containment, quality and safety provision to the patients. Working at any level the role of nurse is to observe the current and emerging trends so that she or he can make innovation in their services and thus improve the quality of their health care provisions. The aim of the nurses and especially the nursing managers is to achieve the shared and mutual goals of efficiency and effectiveness in the practice (Tiffin, 2012). Tiffin, C. (2012), ‘Beyond the Bed Side: The Changing Roles of Nurses Today’, Huffington Post, Retrieved on July 22, 2014 from

Monday, September 23, 2019

Save the world proposal Essay Example | Topics and Well Written Essays - 750 words

Save the world proposal - Essay Example In this proposal, the threats facing this animal will be looked at especially the species belonging to the giant panda. Extinction results into complete eradication of an animal species from the earth surface which has a number of consequences to the ecosystem. The proposal will finally analyze some of the possible ways of saving this species of panda from the imminent eradication and extinction (Gong & Reid 246). The giant panda belongs to the bear family and occupies large parts of china and other areas of New Zealand and Australia. It is an omnivore eating both bamboo leaves and soft tissues sections and small animals found within its habitat. Moreover, it is one of the major sources of tourism revenue in china and New Zealand and foreigners troop these countries to be with this friendly animal. Furthermore, it presents many opportunities for the country that makes it essential for the world life conservancy authorities and groups to develop mechanisms of protecting the animal (Ou yang et al 622). The giant panda is considered as one of the rare species of bear currently available that depends on bamboos and soft tissue plants to survive. Bamboo has however attracted a number of economic applications across different levels of economic activities in the world. As a result, bamboo cutting has significantly increased as people use them for economic purposes or clear the land for farming activities due to increased human population. This deprives the giant panda of its main source of food, thus leaving the animal with small animals as the only alternative source of food. Additionally, the giant panda is slow to reproduce which means that the animal has minimal number of offspring during its lifetime, further increasing its vulnerability to extinction (Entwistle & Dunstone 87). The giant panda should be saved from extinction considering the significant role it plays in reinforcing the efforts of conservation of the flora and fauna. It is considered as one of the most loved animal species not just in china but also in other parts of the country. The region where the giant panda is found is considered as the heartland of Chinese which makes it essential to ensure sustainability in the region. Encouraging sustainability in this region will not only protect the giant panda from extinction but also improve the lifelines of the people around the Yangtze Basin in China. This area acts as the heartland of economic activities in china, being home to both tourist activities, subsistence fisheries and a number of economic activities essential for the growth of the country (Li et al 48). The extinction of the giant panda has a number of ecological, economical and agricultural impacts not just to china but also to the rest of the world. In the event of this extinction, China will end up losing a symbol of its national pride and conservancy efforts. The rate of bamboo consumption in the country will increase tremendously as there will be no concern arisi ng from the existence of the giant panda. This will create significant ecological and agricultural implications to the areas where bamboo is widely grown (Entwistle & Dunstone 87). Despite the widespread concerns on animal and plant conservancy, the benefits achieved maybe are overshadowed by the challenges. Extinction to some scholars is created by natural forces as explained by Darwin theories in relations to the available natural resources. The continued

Sunday, September 22, 2019

Saturday, September 21, 2019

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance The Expression of Long Non-coding RNA UCA1 in Human Ovarian Cancer Cells and Its Role in Cisplatin Cytotoxicity in Vitro Running title: UCA1 in cisplatin induced ovarian cancer cell resistance Highlights Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Abstract Objective: The therapeutic potential of cisplatin in ovarian cancer treatment is limited by the occurrence of cellular resistance. To explore the role of long non-coding RNA UCA1 in cisplatin induced ovarian cancer cell resistance. Methods: Twenty-four ovarian cancer tissues and sixteen normal tissues were used to assess the expression of UCA1 RNA. After expression UCA1 in SKOV3 cells, the cell migration, invasion and cisplatin resistance was assessed. Furthermore, the related mechanism was also explored. In addition, SRPK1 knockdown cell line was established and the effect of SRPK1 on cell migration, invasion and cisplatin resistance was also evaluated. Results: The increased expression of UCA1 RNA was identified in 24 ovarian cancer tissue compared with normal tissue. Expression of UCA1 RNA in SKOV3 cells increased the cell migration, invasion and cisplatin resistance. Alternated expression of SRPK1 and apoptosis related proteins were found in SKOV3/pcDNA-UCA1 cells. The effect of UCA1 expression on cell migration, invasion and cisplatin resistance was reversed by knocking-down SRPK1 in SKOV3 cells. Conclusions: Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Key words: Long non-coding RNA, UCA1, SRPK1, cisplatin resistance, cell migration, invasion Introduction Ovarian cancer is the second most commonly diagnosed gynecological cancer in the world, and causes more deaths per year than any other the female reproductive system related cancer(1). More than 200,000 cases are newly diagnosed and 120,000 women die of ovarian cancer annually all over the world(2). Platinum based chemotherapy is active in ovarian cancer treatment. However, intrinsic or acquired cellular resistance to cisplatin is encountered regularly and severely limits the therapeutic potential of the drug(3). Multiple biological processes, such as dose accumulation, metabolism, apoptosis, DNA damage, are involved in the mechanisms of cellular resistance(4). Conquering cisplatin resistance remains therefore a critical goal for anticancer therapy and considerable efforts have been undertaken to solve this problem throughout the past three decades. Previous studies have shown that serine/arginine-rich protein-specific kinase 1(SRPK1) and apoptosis related protein are closely related with cisplatin resistance. SRPK1 is a kinase which belongs to SR kinase family (5). Through regulating the phosphorylation of SR splicing factors, SRPK1 can afftect the pre-mRNA splicing and consequently gene expression (6). Increasing attentions have been paid on the role of SRPK1 in cisplatin resistance(7-8). The apoptosis resistance induced by anticancer drug treatment has been suggested as another important mechanism in cellular resistance(4). More and more studies have shown that abnormal expression of long non-coding RNA (lncRNA) is involved in tumor development and progression(9). In a previous study, we obtained lncRNA UCA1 using RACE and found that higher expression of lncRNA UCA1 in bladder tumor tissues than normal tissues(10). Here, we tried to assess the expression of UCA1 and SRPK1 in ovarian cancer tissue and normal tissue using RT-PCR and explore the role of UCA1 in cisplatin induced ovarian cancer cell resistance. Our results might provide theoretical basis for chemotherapy selection in clinic and a novel cisplatin resistance related target was also suggested. Methods and materials Cell culture, Patients and Ovarian tumor specimens The human ovarian cancer cell line SKOV3 was maintained at 37 °C and 5% CO2 incubator in RPMI-1640 media with 10% fetal bovine serum, 100 U/ml penicillin, and 100  µg/ml streptomycin. Flash frozen tissue specimens (n= 40) were obtained from patients undergoing debulking surgery for ovarian cancer at People’s hospital of Shaanxi Providence, Shaanxi, China from January 2010 to January 2013. Among the specimens, epithelial ovarian cancer (n=24) were obtained from primary lesion of the patients without radiochemotherapy while normal ovarian samples (n= 16) were obtained from patients undergoing hysterectomies for benign conditions. The pathological examination on all tissues was confirmed by two experienced physician. Written consent was provided by each patient and the whole protocol was proved by the Review Board of the hospital. Reverse transcription PCR analysis Total RNA extraction of cancer tissue or cells were performed with Trizol (Life Tech, US) and the reverse transcription reaction were performed with ImProm II reverse transcriptase(Promega, US) according to the manufacturer’s instruction. UCA1, SRPK1, 18S rRNA specific sequences were amplified during 30 cycles of 30 s denaturing at 95 °C, 60 s annealing at 57 °C, and 60 s extension at 72 °C, with the primers listed in Table 1. Table 1 Primer sequences used in the study Name Forward primer Reverse primer UCA1 CTCTCCATTGGGTTCACCATTC GCGGCAGGTCTTAAGAGATGAG SRPK1 TAACGGACCACTGGACAACAAA TTCCTGCGACCACTCATACTTC 18S rRNA CAGCCACCCGAGATTGAGCA TAGTAGCGACGGGCGGTGTG UCA1 (full length) CGGGATCCTGACATTCTTCTGGACAATGAG CCGGAATTCGCATATTAGCTTTAATGTAGGTGGC Expression of UCA1 in SKOV3 cells The full length of UCA1 was expanded by PCR (The primer was showed in Table 1) at an annealing temperature of 53  °C. After digested with BamHI and EcoRI, the PCR fragment was subcloned into pcDNA3.1 to construct the pcDNA-UCA plasmid. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US). Twenty-four hours later, G418 selection(500  µg/mL) was processed for 3 weeks. The characterization of the positive clone was confimed by RT-PCR. The pcDNA3.1 without UCA1 fragment was used as negative control. RNAi The shRNA sequences of SRPK1 were obtained according to previous description(11). SH1 and SH3, encoding shRNA targeting nucleotides 1423 to 1443 (GGTCAGTCATTCAGTGAACAA) and 288 to 308 (CAAGAAGATCCTAATGATTA), respectively, of the SRPK1 mRNA, were processed with annealing, subcloning into PRNAT-U6.1/Neo plasmid (GenScrpt Corp., Piscataway, NJ, US), plasmid expansion and media amount extraction. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US) and 3 different batch of cells were used for knockdown efficacy examination. Stable cell lines were obtained by G418 selection for 3 weeks. The expression of SRPK1 was confirmed by western-blot analysis. Western-blot analysis The frozen myocardial tissues were lysed in RIPA buffer (Beyotime, China), followed by high speed centrifugation and BCA quantification. Cellular protein was separated by electrophoresis on SDS-PAGE gel and then transferred onto PVDF membrane. After blocking, the blots were incubated with the antibodies to SRPK1 (BD), Bcl-2 (Cell Signaling Technology), BAX (Cell Signaling Technology), caspase-3(Cell Signaling Technology), aspase-3(Cell Signaling Technology). And ÃŽ ²-Actin(Cell Signaling Technology) was used as loading control. The appropriate HPR conjugated secondary antibodies were applied. The protein bands detected with SuperSignal Ultra Chemiluminescent Substrate (Pierce) on X-ray films (Koda). MTT After preparing the single cell suspension, 4Ãâ€"103 cells in 100 ÃŽ ¼L culture media were seeded in 96-well plate in quadruplicate overnight. MTT was added for 4 hr, and formazan dye was dissolved with DMSO and read at 490 nm in a microplate reader (Molecular Device, US). All the experiments were performed for three times. Clonogenic Survival Assay Cells (5Ãâ€"102) were seeded in 6-well plates overnight and incubated with RPMI1640 + 10%FBS + 500 ÃŽ ¼g/ml G418 for 14 day. After removing the media, cells were washed with PBS, fixed with 95% ethanol for 30 min and stained with Giemsa for 15 min. Colonies with >50 cells were counted under microscope. Percentage cell survival is expressed relative to untreated control. Scratch assay 3.0Ãâ€"105 cells were seeded in 6-well plates and the cells were allowed to grow until 90% confluence was reached. Then the cells were grown in 0.2% FBS RPMI1640 media overnight for resting and a scratch was made by using the 200 ÃŽ ¼L pipette tip. The photos were taken at 0 h and 24 h under a microscopy and the relative migrating distances of the wound areas were measured on the images. 3-D migration and Invasion assay Cells (5Ãâ€"105) were seeded in triplicate in upper chamber of the Millicell (8 ÃŽ ¼m pore diameter) which was pre-coated with Matrigel (Becton Dickinson Labware, Bedford, MA). After the lower chamber of the Millicell was added with 900 ÃŽ ¼L RPMI 1640 +20% FBS, the Millicell was incubated at 37 °C and 5% CO2 for 24 hrs. Then the Matrigel was removed by cotton tip, fixed with 95% ethanol for 30 min, stained with Giemsa staining. The membrane was checked with microscopy. The migration assay was similar with invasion assay but with 12 hr incubation time. Cisplatin resistance assay Cells (3Ãâ€"104) were seeded in quadruplicate in 24-well plate and allowed to adhere overnight. Then the cells were treated with serious concentration of cisplatin(0,2.5,5,10, 20,40,80 ÃŽ ¼M) for 48 hr. Cell viability was determined by MTT assay at 490 nm wavelength. Statistical analysis All statistical analyses were performed using the SPSS13.0 software. The results were presented as means  ± SD. Two-tailed Student’s t-test was used to examine the differences between groups. P Results The expression of UCA 1 RNA and SRPK1 mRNA in ovarian tissues Twenty-four ovarian epithelial cancer tissue and sixteen normal ovarian tissue was used to assess the UCA1 and SRPK1 expression. And we found higher expression of UCA 1 RNA and SRPK1 mRNA in ovarian cancer tissue while no significant expression of UCA1 and SRPK1 was found in normal ovarian tissue(Figure 1A). The effect of UCA1 RNA expression on SKVO3 migration and invasion Cell lines establishing After constructing of pcDNA-UCA1, the stable cell lines with or without UCA1 RNA expression were established. The positive control was confirmed by RT-PCR and the result showed that a length of 1442 bp UCA1 RNA was expanded from SKOV3/pcDNA-UCA1 while no UCA1 was found in negative control SKOV3/pcDNA 3.1(Figure 1B). 2-D and 3-D Migration and invasion assay The scratch assay suggested that cell migration ability of SKOV3/pcDNA-UCA1 was significantly increased that of SKOV3/pcDNA 3.1(Figure 1C). The 3-D migration and invasion assay with millicell chamber showed that the migration and invasion abilities were significantly increased in SKOV3/pcDNA-UCA1 cell than SKOV3/pcDNA 3.1 cells(Figure 2A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pcDNA-UCA1 cell. The IC50 of SKOV3/pcDNA-UCA1 cells increased 2.41 times than that of SKOV3/pcDNA 3.1 cells(Figure 2B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 cells (Figure 2C). The effect of SRPK1 knockdown on SKOV3 cells Knockdown cell line establishing The knockdown efficacy of pRNAT-SH1 and pRNAT-SH3 were firstly examined by transient transfestion and western-blot. And the results showed that SKOV3/ pRNAT-SH3 was extend a better effect of knocking down SRPK1 (Figure 3A1). Stable cell lines of SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 were also established and the effect of pRNAT-SH3 on SRPK1 knockdown was showed in Figure 3A2. The proliferation, colongenic, migration, invasion abilities of SRPK1 knockdown The result of MTT assay was showed that decreased proliferation was found in SKOV3/pRNAT-SH3(Figure 3B). The colongenic ability of SKOV3/pRNAT-SH3 was significantly decreased than that of SKOV3/pRNAT-U6.1(Figure 3C). The 3-D migration and cell invasion assay showed that the cell migration and invasion were decreased in SKOV3/pRNAT-SH3 cells than SKOV3/pRNAT-U6.1 cells(Figure 4A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pRNAT-SH3 cell. The IC50 of SKOV3/pRNAT-SH3 cells was increased 2.64 times than that of SKOV3/pRNAT-U6.1 cells(Figure 4B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 cells (Figure 4C). Discussion The lnc RNA UCA1 was cloned in our lab using SMAT-RACE from the bladder cancer cell line BLZ-211. And UCA1 RNA showed an expression pattern of increasing expression in early stage of human embryonic development, differential expression at 28 week of embryonic development, no expression in normal adult tissues. However, the expression of UCA1 RNA was increased in bladder cancer tissues(10). In addition, the increasing expression of UCA1 RNA than the normal or para-carcinoma tissueswas also found in breast cancer, liver cancer, thyroid cancer, cervical cancer, lung cancer, esophagus cancer, gastric cancer and so on(12). We didn’t observe an obvious expression of UCA1 RNA in normal tissues and did observe the expression of UCA1 RNA in ovarian cancer tissues. This suggested UCA1 RNA may extent a critical role in the development and progression of ovarian cancer. The previous study showed that the abilities of cell proliferation, cisplatin resistance, invasion and migration were increased in bladder cancer cell line(13). Yang et al showed that UCA1 can regulate the cell cycle through CREB and PI3K pathway(14). Wang et al found that overexpression of UCA1a(also named as CUDR) in bladder cancer cells would increase the abilities of cell proliferation, invasion and cisplatin resistance and decrease cell apoptosis(15). Wing et al showed that increased expression of UCA1a could increase the cellular resistance and decrease the apoptosis in A431 squamous cancer cells. However, the mechanism is still unknown(16). The cisplatin resistance of ovarian cancer is the main cause of tumor recurrence and the failure of chemotherapy. The mechanisms of cisplatin resistance included dose accumulation of the drug, metabolism, apoptosis and DNA damage and it is a complicate process of multi-factor, multi-level and multi-gene. SKOV3 was used to assess the cisplatin resistance effect in ovarian cancer. We established SKOV3 cell lines expressing UCA1 RNA and found that cell abilities of migration, invasion and cisplatin resistance were increased, which was consistent with the results obtained from the bladder cancer cell lines. Since SRPK1 was proved to involve in the cisplatin resistance(17-18), we also tried to analyze the association between UCA1 RNA and SRPK1. And the western blot results showed that increased expression of SRPK1 and Bcl-2 while decreased expression of Bax, Caspase 3 and Caspase 9. SRPK1 is specific kinase belonged to SR family. It can specifically phosphorylate the SR splice factor and regulate the gene expression by alternative splicing of pre-mRNA of target gene(6). Hayes et al found decreased expression of SRPK1 in pancreas, colon and breast cancer could lead to increasing and decreasing expression of Bcl-2 and Bax. The decreasing on cell proliferation and increasing on cell apoptosis were found (19). Furthermore, increased sensitivities of Gemcitabine and Cisplatin were also found (11, 19). In order to confirm whether SRPK1 is involved in the mechanism of UCA1 regulating ovarian cancer proliferation and migration, we employed RNAi to decrease the expression of SRPK1 and found that increased expression of Bcl-2 and decreased expression of Bax, Caspase 3 and Caspase 9 after downregulating the expression of SRPK1. In addition, we found the increasing abilities on cell proliferation, migration and invasion after SRPK1 knockdown. In conclusion, we found UCA1 RNA may increasing of cell proliferation, decreasing apoptosis and lead to the cisplatin resistance by increasing the expression of SRPK1 and affecting the expression of apoptosis related proteins(such as Bcl-2, Bax, Caspase 3 and Caspase 9). Our results will add novel insight on cisplatin resistance and provide novel molecular target to the treatment.